Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

GRID2IP Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 392862 glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein chr7 - 6590567 - 6596067 6591067 Transcription Factor Binding Sites   Download all TFBS in the GRID2IP promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 6596027 6596045 2.0E-06 TGGCCACCAGAGGGCCCAG 19 znf143_MA0088.1 JASPAR + 6586617 6586636 1.0E-06 CATTTCCCAGCATCCTTAGG 20 V_MEQ_01_M02049 TRANSFAC + 6586601 6586609 9.0E-06 GACACACAT 9 V_MYOD_Q6_M00184 TRANSFAC - 6586676 6586685 2.0E-06 AGCACCTGTC 10 V_STAF_01_M00262 TRANSFAC + 6586618 6586639 7.0E-06 ATTTCCCAGCATCCTTAGGGAG 22 V_CTCF_02_M01259 TRANSFAC + 6596024 6596043 3.0E-06 ACCTGGCCACCAGAGGGCCC 20 V_CTCF_01_M01200 TRANSFAC + 6596026 6596045 2.0E-06 CTGGCCACCAGAGGGCCCAG 20 V_MYOD_01_M00001 TRANSFAC + 6586675 6586686 3.0E-06 GGACAGGTGCTG 12 V_LUN1_01_M00480 TRANSFAC + 6586621 6586637 3.0E-06 TCCCAGCATCCTTAGGG 17 V_PR_02_M00957 TRANSFAC + 6586670 6586696 9.0E-06 ATTGAGGACAGGTGCTGTTCTAAGAGG 27

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.