Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C1QTNF8 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 390664 C1q and tumor necrosis factor related protein 8 chr16 - 1145744 - 1151244 1146244 Transcription Factor Binding Sites   Download all TFBS in the C1QTNF8 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ESRRA_nuclearreceptor_DBD_dimeric_19_1 SELEX + 1143537 1143555 9.0E-06 GAAGGTGATGTAGAGGTCT 19 RARA_nuclearreceptor_full_dimeric_18_1 SELEX - 1147833 1147850 7.0E-06 ACGGGTCATCCCGGGCCA 18 ESRRG_nuclearreceptor_full_dimeric_18_1 SELEX + 1143538 1143555 4.0E-06 AAGGTGATGTAGAGGTCT 18 Rarb_nuclearreceptor_DBD_dimeric_17_1 SELEX + 1143539 1143555 4.0E-06 AGGTGATGTAGAGGTCT 17 Gfi_MA0038.1 JASPAR + 1143138 1143147 2.0E-06 CAAATCACAG 10 RARA_nuclearreceptor_full_dimeric_17_1 SELEX + 1143539 1143555 7.0E-06 AGGTGATGTAGAGGTCT 17 RXR_RAR_DR5_MA0159.1 JASPAR + 1143539 1143555 3.0E-06 AGGTGATGTAGAGGTCT 17 V_AP1_Q2_M00173 TRANSFAC + 1147957 1147967 1.0E-06 GGTGACTCAGT 11 V_XVENT1_01_M00445 TRANSFAC - 1141355 1141367 5.0E-06 GTGCTATTTGTGG 13 V_AP1_Q6_M00174 TRANSFAC + 1147957 1147967 2.0E-06 GGTGACTCAGT 11 V_GFI1_01_M00250 TRANSFAC + 1143132 1143155 1.0E-06 GCTCAACAAATCACAGCACACAGT 24 V_AP1_Q4_M00188 TRANSFAC + 1147957 1147967 1.0E-06 GGTGACTCAGT 11 V_HIC1_02_M01072 TRANSFAC + 1148054 1148068 6.0E-06 GCCGGGTGCCCTGGG 15 V_GFI1_Q6_M01067 TRANSFAC + 1143137 1143149 5.0E-06 ACAAATCACAGCA 13 V_AP1FJ_Q2_M00172 TRANSFAC + 1147957 1147967 0.0E+00 GGTGACTCAGT 11 V_GFI1B_01_M01058 TRANSFAC + 1143138 1143149 1.0E-06 CAAATCACAGCA 12 V_RXR_RAR_01_M02272 TRANSFAC + 1143539 1143555 3.0E-06 AGGTGATGTAGAGGTCT 17 V_NFE2_01_M00037 TRANSFAC - 1147958 1147968 6.0E-06 CACTGAGTCAC 11 V_GFI1_Q6_01_M02010 TRANSFAC - 1143138 1143147 2.0E-06 CTGTGATTTG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.