Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ANKRD34C Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 390616 chr15 + 79570145 - 79580145 0 Transcription Factor Binding Sites   Download all TFBS in the ANKRD34C promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints REST_MA0138.2 JASPAR + 79576098 79576118 0.0E+00 TTCAGCACCTCGGACAGAGCC 21 V_AP2ALPHA_Q6_M01857 TRANSFAC + 79576170 79576180 2.0E-06 AGCCCCCGGCC 11 V_NRSF_Q4_M01028 TRANSFAC - 79576099 79576117 0.0E+00 GCTCTGTCCGAGGTGCTGA 19 V_NRSE_B_M00325 TRANSFAC + 79576098 79576118 0.0E+00 TTCAGCACCTCGGACAGAGCC 21 V_REST_01_M01256 TRANSFAC - 79576101 79576122 0.0E+00 CTCGGGCTCTGTCCGAGGTGCT 22 V_CNOT3_01_M01253 TRANSFAC - 79576076 79576085 4.0E-06 GGCCGCGCCG 10 V_NRSF_01_M00256 TRANSFAC + 79576098 79576118 0.0E+00 TTCAGCACCTCGGACAGAGCC 21 V_REST_02_M02256 TRANSFAC + 79576098 79576118 0.0E+00 TTCAGCACCTCGGACAGAGCC 21

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.