Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR6C70 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 390327 olfactory receptor, family 6, subfamily C, member 70 chr12 - 55863422 - 55868922 55863922 Transcription Factor Binding Sites   Download all TFBS in the OR6C70 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NFE2_bZIP_DBD_dimeric_11_1 SELEX + 55864366 55864376 6.0E-06 AGTGACTCATG 11 NFE2_bZIP_DBD_dimeric_11_1 SELEX - 55864366 55864376 9.0E-06 CATGAGTCACT 11 JDP2_bZIP_full_dimeric_9_1 SELEX - 55864367 55864375 1.0E-05 ATGAGTCAC 9 V_IRF_Q6_01_M00972 TRANSFAC + 55861831 55861841 9.0E-06 GGAAATGAAAC 11 V_IRF2_Q6_M01882 TRANSFAC + 55861829 55861844 5.0E-06 GAGGAAATGAAACATA 16 V_PITX2_Q6_M02114 TRANSFAC + 55864379 55864388 1.0E-06 TGTAATCCCA 10 V_BACH1_01_M00495 TRANSFAC - 55864364 55864378 6.0E-06 GGCATGAGTCACTGT 15 V_BEL1_B_M00312 TRANSFAC - 55861825 55861852 1.0E-06 AATAAGCTTATGTTTCATTTCCTCCAAA 28 V_IRF_Q6_M00772 TRANSFAC - 55861831 55861845 1.0E-06 TTATGTTTCATTTCC 15 V_PITX2_Q2_M00482 TRANSFAC + 55864379 55864389 1.0E-06 TGTAATCCCAG 11 V_ARP1_01_M00155 TRANSFAC - 55864418 55864433 5.0E-06 TCAACTCCTGGCCCCA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.