Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR5W2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 390148 olfactory receptor, family 5, subfamily W, member 2 chr11 - 55681558 - 55687058 55682058 Transcription Factor Binding Sites   Download all TFBS in the OR5W2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Mafb_bZIP_DBD_monomeric_12_1 SELEX - 55684150 55684161 2.0E-06 AAAATGCTGAGA 12 MAFK_bZIP_full_monomeric_12_1 SELEX - 55684151 55684162 4.0E-06 CAAAATGCTGAG 12 V_BEL1_B_M00312 TRANSFAC - 55684134 55684161 1.0E-06 AAAATGCTGAGATTACAGGCTTGAGCCA 28 V_ZFP161_04_M02933 TRANSFAC - 55684121 55684134 1.0E-05 ACCGCGCAGGGCCA 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.