Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 389763 SPATA31 subfamily D, member 1 chr9 + 84598686 - 84604186 84603686 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints JDP2_bZIP_full_dimeric_9_1 SELEX + 84600010 84600018 7.0E-06 ATGACTCAC 9 RXR_RAR_DR5_MA0159.1 JASPAR - 84601073 84601089 6.0E-06 GGGTCATGTAAATGTGA 17 V_HFH4_01_M00742 TRANSFAC + 84600081 84600093 8.0E-06 CTGCATTTGTATA 13 V_BACH1_01_M00495 TRANSFAC - 84600007 84600021 3.0E-06 ACTGTGAGTCATAAC 15 V_GFI1_01_M00250 TRANSFAC - 84599961 84599984 7.0E-06 TAGCAAAAAATCCCTGCATGTGCA 24 V_JUNDM2_04_M02876 TRANSFAC + 84600006 84600021 1.0E-06 AGTTATGACTCACAGT 16 V_AP1_01_M00517 TRANSFAC - 84600008 84600020 8.0E-06 CTGTGAGTCATAA 13 V_BRACH_01_M00150 TRANSFAC - 84601138 84601161 7.0E-06 AGAGTGAGACTTAGGTGTGTCAAA 24 V_AP1_Q2_01_M00924 TRANSFAC + 84600011 84600022 7.0E-06 TGACTCACAGTA 12 V_AP1_Q4_01_M00926 TRANSFAC - 84600010 84600017 1.0E-05 TGAGTCAT 8 V_CIZ_01_M00734 TRANSFAC - 84599973 84599981 4.0E-06 CAAAAAATC 9 V_FRA1_Q5_M01267 TRANSFAC - 84600010 84600017 1.0E-05 TGAGTCAT 8 V_RXR_RAR_01_M02272 TRANSFAC - 84601073 84601089 6.0E-06 GGGTCATGTAAATGTGA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.