Search TFs
or Genes		 Construction
and Validation		 Optimal
Promoter Size		 Download Citation and
Contact


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)		TSS
389523 chr7 +74374082 - 74384082 0

Transcription Factor Binding Sites

 
Download all TFBS in the promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence		Overlap w/
Footprints
V_LMO2COM_01_M00277 TRANSFAC + 74381586 74381597 6.0E-06 CCCCAGGTGGTG 12
V_CTCF_01_M01200 TRANSFAC - 74381580 74381599 5.0E-06 GTCACCACCTGGGGGCAGGG 20
V_MEIS1_01_M00419 TRANSFAC - 74381605 74381616 9.0E-06 AAGTGACAGAGC 12
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL