Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C1orf146 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 388649 chromosome 1 open reading frame 146 chr1 + 92678572 - 92684072 92683572 Transcription Factor Binding Sites   Download all TFBS in the C1orf146 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_FOXP1_01_M00987 TRANSFAC + 92678588 92678607 8.0E-06 ACATTTGTGTATTCAATTTC 20 V_HBP1_03_M02762 TRANSFAC - 92684796 92684811 9.0E-06 TTTGTGAATGAGTAAA 16 V_ZFP281_01_M01597 TRANSFAC - 92684773 92684783 5.0E-06 TGGGGGAAGGG 11 V_OCT1_07_M00248 TRANSFAC - 92678602 92678613 3.0E-06 TATATTGAAATT 12 V_SOX1_03_M02802 TRANSFAC - 92678594 92678609 7.0E-06 TTGAAATTGAATACAC 16 V_SOX15_04_M02903 TRANSFAC - 92678599 92678613 8.0E-06 TATATTGAAATTGAA 15 V_UF1H3BETA_Q6_M01068 TRANSFAC - 92684772 92684785 2.0E-06 GCTGGGGGAAGGGC 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.