Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

INS Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 3630 chr11 + 2177439 - 2187439 0 Transcription Factor Binding Sites   Download all TFBS in the INS promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR - 2177859 2177877 0.0E+00 CGACCAGCAGATGGCATCA 19 TEAD1_TEA_full_monomeric_10_1 SELEX - 2178368 2178377 2.0E-06 CACATTCCTT 10 TEAD4_TEA_DBD_monomeric_10_1 SELEX - 2178368 2178377 2.0E-06 CACATTCCTT 10 V_CTCF_02_M01259 TRANSFAC - 2177861 2177880 1.0E-06 GTGCGACCAGCAGATGGCAT 20 V_CTCF_01_M01200 TRANSFAC - 2177859 2177878 1.0E-06 GCGACCAGCAGATGGCATCA 20 V_EKLF_Q5_M01874 TRANSFAC - 2177909 2177918 5.0E-06 CCACACCCAG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.