Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 353164 chr12 + 11334543 - 11344543 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_HNF3_Q6_01_M01012 TRANSFAC - 11335282 11335299 2.0E-06 TTGTATATTTGCACAGTC 18 V_OCT1_04_M00138 TRANSFAC + 11335278 11335300 2.0E-06 AAATGACTGTGCAAATATACAAA 23 V_NRF2_Q4_M00821 TRANSFAC - 11335279 11335291 9.0E-06 TTGCACAGTCATT 13 V_NFE2_Q6_M02104 TRANSFAC + 11335279 11335294 9.0E-06 AATGACTGTGCAAATA 16 V_TCF11MAFG_01_M00284 TRANSFAC + 11335275 11335296 0.0E+00 GCAAAATGACTGTGCAAATATA 22 V_TCF11_01_M00285 TRANSFAC - 11335272 11335284 8.0E-06 GTCATTTTGCTTT 13

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.