Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

LCE1D Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 353134 late cornified envelope 1D chr1 + 152764226 - 152769726 152769226 Transcription Factor Binding Sites   Download all TFBS in the LCE1D promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints SP4_C2H2_full_monomeric_17_1 SELEX + 152766955 152766971 6.0E-06 CTGACCACTCCCCCATT 17 SP1_C2H2_DBD_monomeric_11_1 SELEX + 152766958 152766968 8.0E-06 ACCACTCCCCC 11 V_HOX13_01_M00023 TRANSFAC + 152766956 152766985 0.0E+00 TGACCACTCCCCCATTACTAAGCCCTTTGG 30

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.