Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CXorf66 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 347487 chromosome X open reading frame 66 chrX - 139047177 - 139052677 139047677 Transcription Factor Binding Sites   Download all TFBS in the CXorf66 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints znf143_MA0088.1 JASPAR - 139048489 139048508 7.0E-06 TGTCACCCAGGCTGCAGTGC 20 Evi1_MA0029.1 JASPAR + 139048427 139048440 5.0E-06 AACACAAGACAATC 14 V_RELBP52_01_M01239 TRANSFAC + 139049672 139049681 8.0E-06 GGGGATTTCT 10 V_LUN1_01_M00480 TRANSFAC + 139048407 139048423 9.0E-06 TCCCAGCTACTCAGGAG 17 V_TCF11MAFG_01_M00284 TRANSFAC + 139048498 139048519 8.0E-06 CCTGGGTGACAGAGCAAGACTC 22 V_TCF11MAFG_01_M00284 TRANSFAC + 139049699 139049720 2.0E-06 CTCAATTGACAGTGCAATTCCG 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.