Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PRSS48 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 345062 protease, serine, 48 chr4 + 152193324 - 152198824 152198324 Transcription Factor Binding Sites   Download all TFBS in the PRSS48 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 152198095 152198113 1.0E-06 AGGACAGCAGGGGGCGCCA 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 152198096 152198112 4.0E-06 GGCGCCCCCTGCTGTCC 17 V_CTCF_01_M01200 TRANSFAC + 152198094 152198113 3.0E-06 CAGGACAGCAGGGGGCGCCA 20 V_NRSF_01_M00256 TRANSFAC + 152198054 152198074 7.0E-06 CTCAACACCACAGGCAGAAAC 21

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.