Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 342574 chr17 + 38933786 - 38943786 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_RFX4_03_M02789 TRANSFAC - 38935752 38935766 2.0E-06 CCTCTTAGCAACGGT 15 V_RFXDC2_03_M02790 TRANSFAC - 38935752 38935766 2.0E-06 CCTCTTAGCAACGGT 15 V_GCNF_01_M00526 TRANSFAC + 38935769 38935786 0.0E+00 CTGAAGTTCAATCTCAAG 18 V_RFX3_04_M02788 TRANSFAC - 38935748 38935770 1.0E-06 AGTCCCTCTTAGCAACGGTAAGC 23

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.