Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SYT10 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 341359 synaptotagmin X chr12 - 33592254 - 33597754 33592754 Transcription Factor Binding Sites   Download all TFBS in the SYT10 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints IRF1_MA0050.1 JASPAR + 33592779 33592790 8.0E-06 AAAAGCCAAAGC 12 V_ZNF219_01_M01122 TRANSFAC - 33592761 33592772 1.0E-06 CTCCCCCCTCCC 12 V_MAZ_Q6_01_M02023 TRANSFAC - 33592816 33592829 7.0E-06 TGGGGAGAGGAGGG 14 V_P53_05_M01655 TRANSFAC - 33592777 33592796 4.0E-06 GGGCTTGCTTTGGCTTTTTT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.