Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

LRIT2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 340745 chr10 + 85980284 - 85990284 0 Transcription Factor Binding Sites   Download all TFBS in the LRIT2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints REST_MA0138.2 JASPAR - 85984613 85984633 0.0E+00 CTCAGTACCATGGACAGCGTT 21 V_E2A_Q6_01_M02088 TRANSFAC - 85984671 85984683 8.0E-06 GAACACCTGCCAG 13 V_NRSF_Q4_M01028 TRANSFAC + 85984614 85984632 1.0E-05 ACGCTGTCCATGGTACTGA 19 V_REST_01_M01256 TRANSFAC + 85984609 85984630 0.0E+00 ACGGAACGCTGTCCATGGTACT 22 V_NRSF_01_M00256 TRANSFAC - 85984613 85984633 0.0E+00 CTCAGTACCATGGACAGCGTT 21 V_REST_02_M02256 TRANSFAC - 85984613 85984633 0.0E+00 CTCAGTACCATGGACAGCGTT 21 V_P300_01_M00033 TRANSFAC + 85984550 85984563 3.0E-06 TCAGGGAGTGCATC 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.