Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PABPC1L2B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 340529 chrX + 72294351 - 72304351 0 Transcription Factor Binding Sites   Download all TFBS in the PABPC1L2B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints MEF2D_MADS_DBD_dimeric_12_1 SELEX - 72296858 72296869 1.0E-05 GCTAAAAGTAGA 12 V_MEF2_02_M00231 TRANSFAC - 72296854 72296875 2.0E-06 GTCATTGCTAAAAGTAGAATTC 22 V_RSRFC4_Q2_M00407 TRANSFAC - 72296855 72296871 4.0E-06 TTGCTAAAAGTAGAATT 17 V_MEF2_03_M00232 TRANSFAC - 72296854 72296875 1.0E-05 GTCATTGCTAAAAGTAGAATTC 22 V_MEF2_04_M00233 TRANSFAC - 72296854 72296875 1.0E-06 GTCATTGCTAAAAGTAGAATTC 22 V_RSRFC4_01_M00026 TRANSFAC + 72296856 72296871 6.0E-06 ATTCTACTTTTAGCAA 16 V_PAX6_01_M00097 TRANSFAC + 72296841 72296861 9.0E-06 TACTTTGACACATGAATTCTA 21

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.