Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 319101 chr12 + 53007343 - 53017343 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_ZEC_01_M01081 TRANSFAC - 53009460 53009472 7.0E-06 GTTGGTAGGTTGT 13 V_SPIB_01_M01204 TRANSFAC - 53009369 53009385 7.0E-06 GGGAAGAGGAAGAACCT 17 V_ELF1_Q6_M00746 TRANSFAC - 53009373 53009384 3.0E-06 GGAAGAGGAAGA 12 V_CAAT_C_M00200 TRANSFAC + 53009467 53009491 9.0E-06 ACCAACAACTCCCCTCCATCCCTAG 25 V_STAT6_02_M00500 TRANSFAC + 53009341 53009348 1.0E-05 GATTTCCT 8

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.