Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

GSTT2B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2953 chr22 + 24317313 - 24327313 0 Transcription Factor Binding Sites   Download all TFBS in the GSTT2B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Foxc1_forkhead_DBD_dimeric_11_1 SELEX + 24326785 24326795 7.0E-06 ACCAATAAACA 11 CTCF_C2H2_full_monomeric_17_1 SELEX - 24326764 24326780 6.0E-06 AGTGACATCTACTGTCA 17 HOXA13_homeodomain_full_monomeric_10_1 SELEX + 24326786 24326795 4.0E-06 CCAATAAACA 10 HOXB13_homeodomain_DBD_monomeric_10_1 SELEX + 24326786 24326795 5.0E-06 CCAATAAACA 10 V_LMAF_Q2_M01139 TRANSFAC - 24326779 24326787 6.0E-06 GGTCAGCAG 9 V_AFP1_Q6_M00616 TRANSFAC + 24326789 24326799 1.0E-05 ATAAACAGGAT 11 V_CETS1P54_02_M00074 TRANSFAC + 24326791 24326803 4.0E-06 AAACAGGATGTTC 13 V_SPDEF_03_M02811 TRANSFAC - 24326788 24326803 4.0E-06 GAACATCCTGTTTATT 16 V_CTCF_02_M01259 TRANSFAC + 24326760 24326779 8.0E-06 AATGTGACAGTAGATGTCAC 20 V_ELK1_01_M00007 TRANSFAC + 24326790 24326805 0.0E+00 TAAACAGGATGTTCCA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.