Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

GRIK1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2897 glutamate receptor, ionotropic, kainate 1 chr21 - 31311782 - 31317282 31312282 Transcription Factor Binding Sites   Download all TFBS in the GRIK1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints POU3F1_POU_DBD_monomeric_12_2 SELEX - 31311828 31311839 1.0E-05 ATGAATTAAGAA 12 V_BCL6_02_M01185 TRANSFAC - 31312120 31312133 4.0E-06 AACTTTCCTCAGCT 14 V_MUSCLE_INI_B_M00321 TRANSFAC - 31312014 31312034 4.0E-06 TAGCGACAGCACTGAGGAGCC 21 V_STAT3_03_M01595 TRANSFAC + 31312522 31312537 4.0E-06 GCTGCTGGGAAGTCGA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.