Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FAM115C Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 285966 family with sequence similarity 115, member C chr7 + 143313044 - 143319041 143318541 Transcription Factor Binding Sites   Download all TFBS in the FAM115C promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 143317320 143317338 0.0E+00 TGACCACTAGGGGGCAGCC 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 143317321 143317337 4.0E-06 GCTGCCCCCTAGTGGTC 17 V_SP1_Q6_01_M00931 TRANSFAC - 143318027 143318036 4.0E-06 GGGGCGGGGC 10 V_AP4_Q6_02_M01860 TRANSFAC - 143317310 143317322 5.0E-06 TCAGCTGCGGGCC 13 V_SP1_Q6_M00196 TRANSFAC - 143318026 143318038 7.0E-06 GCGGGGCGGGGCG 13 V_CTCF_02_M01259 TRANSFAC + 143317317 143317336 0.0E+00 AGCTGACCACTAGGGGGCAG 20 V_CTCF_01_M01200 TRANSFAC + 143317319 143317338 0.0E+00 CTGACCACTAGGGGGCAGCC 20 V_SP4_Q5_M01273 TRANSFAC + 143318027 143318037 2.0E-06 GCCCCGCCCCG 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.