Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

POM121L12 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 285877 chr7 + 53098348 - 53108348 0 Transcription Factor Binding Sites   Download all TFBS in the POM121L12 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints VENTX_homeodomain_DBD_dimeric_21_1 SELEX + 53108113 53108133 7.0E-06 GATTACTGGCAAAGCCACTAG 21 V_SOX12_04_M02900 TRANSFAC + 53108154 53108169 4.0E-06 GTACAGATAAAGGAAA 16 V_SOX12_04_M02900 TRANSFAC + 53108167 53108182 2.0E-06 AAAGGGACAAAGGAAC 16 V_GATA4_Q3_M00632 TRANSFAC + 53108158 53108169 7.0E-06 AGATAAAGGAAA 12 V_GATA1_02_M00126 TRANSFAC + 53108154 53108167 7.0E-06 GTACAGATAAAGGA 14 V_NANOG_02_M01247 TRANSFAC + 53108165 53108184 4.0E-06 GGAAAGGGACAAAGGAACCA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.