Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C5orf60 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 285679 chr5 + 179067047 - 179077047 0 Transcription Factor Binding Sites   Download all TFBS in the C5orf60 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Pax4_MA0068.1 JASPAR + 179067029 179067058 7.0E-06 AAATATTTGCCAACAACAAATCAAACAACT 12 POU1F1_POU_DBD_monomeric_17_1 SELEX - 179067061 179067077 3.0E-06 TTCATGCATTTTTGAAT 17 RREB1_MA0073.1 JASPAR + 179067042 179067061 3.0E-06 CAACAAATCAAACAACTCAA 15 V_FOXP1_01_M00987 TRANSFAC - 179067051 179067070 8.0E-06 ATTTTTGAATTGAGTTGTTT 20 V_HNF3B_01_M00131 TRANSFAC - 179067046 179067060 7.0E-06 TGAGTTGTTTGATTT 14 V_FLI1_Q6_M01208 TRANSFAC + 179068441 179068451 8.0E-06 AAGGAAGTCAC 11 V_POU3F2_01_M00463 TRANSFAC - 179067061 179067074 3.0E-06 ATGCATTTTTGAAT 14 V_SOX1_03_M02802 TRANSFAC + 179067056 179067071 1.0E-06 ACTCAATTCAAAAATG 16 V_DR3_Q4_M00966 TRANSFAC - 179067064 179067084 6.0E-06 AGTCCCCTTCATGCATTTTTG 21 V_MAFK_04_M02880 TRANSFAC + 179067062 179067076 4.0E-06 TTCAAAAATGCATGA 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.