Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FAM71E2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 284418 chr19 + 55869620 - 55879620 0 Transcription Factor Binding Sites   Download all TFBS in the FAM71E2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints STAT1_MA0137.2 JASPAR + 55870513 55870527 2.0E-06 CTCTTCCAGGAATTC 15 Stat3_MA0144.1 JASPAR - 55870515 55870524 2.0E-06 TTCCTGGAAG 10 V_NF1_Q6_01_M00806 TRANSFAC - 55870529 55870545 5.0E-06 TTGACGTGTTGCCAACA 17 V_STAT5B_01_M00459 TRANSFAC - 55870513 55870527 3.0E-06 GAATTCCTGGAAGAG 15 V_STAT1_05_M01260 TRANSFAC - 55870506 55870527 3.0E-06 GAATTCCTGGAAGAGCCGTGCT 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.