Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

KLK9 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 284366 kallikrein-related peptidase 9 chr19 - 51512390 - 51517890 51512890 Transcription Factor Binding Sites   Download all TFBS in the KLK9 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints HSF1_HSF_full_trimeric_13_1 SELEX + 51513483 51513495 9.0E-06 TTGCAGAACCTTC 13 V_BACH1_01_M00495 TRANSFAC - 51513841 51513855 1.0E-05 GAGATGAGTCAGACC 15 V_MATH1_Q2_M01716 TRANSFAC - 51513807 51513816 9.0E-06 CCACCTGGTG 10 V_HOX13_01_M00023 TRANSFAC + 51513782 51513811 7.0E-06 TGCCTCTCTCCTCATCATTCCTTCTCACCA 30 V_AP1_C_M00199 TRANSFAC - 51513844 51513852 3.0E-06 ATGAGTCAG 9

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.