Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FADS6 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 283985 fatty acid desaturase 6 chr17 - 72889205 - 72894705 72889705 Transcription Factor Binding Sites   Download all TFBS in the FADS6 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_P53_04_M01652 TRANSFAC + 72894672 72894691 6.0E-06 AAGCAGGCCTGGGCAGGCTC 20 V_P53_04_M01652 TRANSFAC - 72894672 72894691 2.0E-06 GAGCCTGCCCAGGCCTGCTT 20 V_P53_01_M00034 TRANSFAC + 72894672 72894691 6.0E-06 AAGCAGGCCTGGGCAGGCTC 20 V_P53_01_M00034 TRANSFAC - 72894672 72894691 5.0E-06 GAGCCTGCCCAGGCCTGCTT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.