Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

UTS2R Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2837 urotensin 2 receptor chr17 + 80327200 - 80332700 80332200 Transcription Factor Binding Sites   Download all TFBS in the UTS2R promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NR2F1_MA0017.1 JASPAR + 80328584 80328597 8.0E-06 TGACCCTTGCTCCG 14 V_DEAF1_01_M01001 TRANSFAC - 80330911 80330935 2.0E-06 CCGTGACCGGGGACTTCCTGAAAAG 25 V_COUPTF_Q6_M01036 TRANSFAC + 80328579 80328601 9.0E-06 TTGTGTGACCCTTGCTCCGTCCA 23 V_COUP_01_M00158 TRANSFAC + 80328584 80328597 8.0E-06 TGACCCTTGCTCCG 14 V_IRF4_03_M02768 TRANSFAC - 80328530 80328544 2.0E-06 CGAACTGAAACCAAA 15 V_MZF1_02_M00084 TRANSFAC + 80334487 80334499 1.0E-05 GGAAGAGGGGCAA 13 V_ICSBP_Q6_M00699 TRANSFAC - 80328532 80328543 4.0E-06 GAACTGAAACCA 12 V_IRF6_03_M02770 TRANSFAC - 80328528 80328544 4.0E-06 CGAACTGAAACCAAATA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.