Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

IL36A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 27179 chr2 + 113758448 - 113768448 0 Transcription Factor Binding Sites   Download all TFBS in the IL36A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NFATC1_NFAT_full_dimeric_20_1 SELEX + 113767750 113767769 2.0E-06 TGTGGAAATGCTGTTTTCCT 20 V_ELF5_03_M02057 TRANSFAC - 113767884 113767893 8.0E-06 CCAGGAAAAA 10 V_EVI1_04_M00081 TRANSFAC - 113767717 113767731 3.0E-06 GGACAAGTAAAAATA 15 V_NFAT3_Q3_M01734 TRANSFAC + 113767882 113767891 6.0E-06 ATTTTTTCCT 10 V_TCFAP2E_04_M02926 TRANSFAC - 113767881 113767894 8.0E-06 ACCAGGAAAAAATG 14 V_POU3F2_01_M00463 TRANSFAC + 113767878 113767891 1.0E-05 TTACATTTTTTCCT 14 V_RFX3_05_M02892 TRANSFAC + 113767882 113767904 3.0E-06 ATTTTTTCCTGGTGACAGCATAG 23

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.