Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

IL36B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 27177 interleukin 36, beta chr2 - 113809940 - 113815440 113810440 Transcription Factor Binding Sites   Download all TFBS in the IL36B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_DAX1_01_M01248 TRANSFAC + 113811808 113811827 9.0E-06 GAAGAGCAAAGTCACATCTT 20 V_AP1_Q2_01_M00924 TRANSFAC + 113811753 113811764 1.0E-06 TGACTCACAGTT 12

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.