Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

GH2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2689 growth hormone 2 chr17 - 61958802 - 61964302 61959302 Transcription Factor Binding Sites   Download all TFBS in the GH2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 61959775 61959793 0.0E+00 TGACCACTAGAGGGAACAA 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 61959776 61959792 5.0E-06 TGTTCCCTCTAGTGGTC 17 V_AREB6_01_M00412 TRANSFAC + 61959813 61959825 9.0E-06 CCTTTACCTGAGC 13 V_EBF_Q6_M00977 TRANSFAC - 61959918 61959928 8.0E-06 GTCCCCAGGGA 11 V_ZBED6_01_M01598 TRANSFAC + 61959732 61959743 6.0E-06 TGGGCTCGCCTG 12 V_CTCF_02_M01259 TRANSFAC + 61959772 61959791 0.0E+00 TACTGACCACTAGAGGGAAC 20 V_CTCF_01_M01200 TRANSFAC + 61959774 61959793 0.0E+00 CTGACCACTAGAGGGAACAA 20 V_ZBTB3_03_M02825 TRANSFAC - 61959756 61959772 7.0E-06 ATTAGCACTGCATCCAG 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.