Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR10H1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 26539 olfactory receptor, family 10, subfamily H, member 1 chr19 - 15918436 - 15923936 15918936 Transcription Factor Binding Sites   Download all TFBS in the OR10H1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints PBX1_MA0070.1 JASPAR - 15922991 15923002 6.0E-06 AGATCAATCAGA 12 Myf_MA0055.1 JASPAR - 15923037 15923048 1.0E-06 CAGCAACTGGTG 12 V_DR4_Q2_M00965 TRANSFAC + 15923010 15923026 9.0E-06 TGTCTTTTCCTAACCTC 17 V_AREB6_04_M00415 TRANSFAC + 15923053 15923061 8.0E-06 CTGTTTCAA 9 V_MYF_01_M01302 TRANSFAC - 15923037 15923048 1.0E-06 CAGCAACTGGTG 12 V_OCT1_04_M00138 TRANSFAC + 15923114 15923136 5.0E-06 TCATATCAATTCAGATCACAAGA 23 V_TCF4_Q5_M00671 TRANSFAC - 15923057 15923064 1.0E-05 CCTTTGAA 8 V_PBX1_03_M01017 TRANSFAC - 15922991 15923002 2.0E-06 AGATCAATCAGA 12

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.