Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PCDHB5 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 26167 protocadherin beta 5 chr5 + 140509799 - 140515299 140514799 Transcription Factor Binding Sites   Download all TFBS in the PCDHB5 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints POU3F3_POU_DBD_monomeric_12_1 SELEX - 140514742 140514753 9.0E-06 TTGCATATAGTA 12 POU3F2_POU_DBD_monomeric_13_1 SELEX - 140514742 140514754 8.0E-06 ATTGCATATAGTA 13 YY1_C2H2_full_monomeric_11_1 SELEX + 140514822 140514832 8.0E-06 GACGCCATTAA 11 Lhx3_MA0135.1 JASPAR - 140514751 140514763 6.0E-06 TAATTTACTATTG 13 V_HTF_01_M00538 TRANSFAC + 140514700 140514723 8.0E-06 GTATGGATACACGTCAGTTAGAAT 24 V_MYBL1_04_M02884 TRANSFAC - 140514709 140514723 9.0E-06 ATTCTAACTGACGTG 15 V_YY1_03_M02044 TRANSFAC + 140514822 140514833 9.0E-06 GACGCCATTAAG 12 V_AIRE_01_M00999 TRANSFAC + 140514718 140514743 4.0E-06 TAGAATTTAGGATGAAATGGCAAATA 26

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.