Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FDCSP Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 260436 follicular dendritic cell secreted protein chr4 + 71086787 - 71092287 71091787 Transcription Factor Binding Sites   Download all TFBS in the FDCSP promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Sox1_HMG_DBD_dimeric_13_1 SELEX + 71090348 71090360 9.0E-06 TCAAAAGAATTGA 13 V_HP1SITEFACTOR_Q6_M00725 TRANSFAC + 71090343 71090354 1.0E-05 AAATGTCAAAAG 12 V_BRACH_01_M00150 TRANSFAC + 71090331 71090354 6.0E-06 ATAGTCACAGTTAAATGTCAAAAG 24 V_T3RBETA_Q6_01_M02119 TRANSFAC + 71090360 71090376 5.0E-06 AAGTAACACAAGGACAG 17 V_NANOG_02_M01247 TRANSFAC + 71090340 71090359 5.0E-06 GTTAAATGTCAAAAGAATTG 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.