Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 25832 chr1 + 148020848 - 148030848 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_EVI1_04_M00081 TRANSFAC + 148025073 148025087 1.0E-05 AGAAAGAATAGAAAA 15 V_HP1SITEFACTOR_Q6_M00725 TRANSFAC + 148025086 148025097 9.0E-06 AATGGTTTACAG 12 V_NANOG_02_M01247 TRANSFAC + 148025069 148025088 8.0E-06 CAAGAGAAAGAATAGAAAAT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.