Search TFs
or Genes
Construction
and Validation
Optimal
Promoter Size
Download Citation and
Contact

B4GALNT1


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)
TSS
2583 beta-1,4-N-acetyl-galactosaminyl transferase 1 chr12 -58026485 - 58031985 58026985

Transcription Factor Binding Sites

 
Download all TFBS in the B4GALNT1 promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence
Overlap w/
Footprints
CTCF_MA0139.1 JASPAR - 58026993 58027011 4.0E-06 CGCCCACTAGAAGGCGCCG 19
TFAP2B_TFAP_DBD_dimeric_12_1 SELEX + 58026836 58026847 9.0E-06 AGCCCCGGGGCA 12
CTCF_C2H2_full_monomeric_17_1 SELEX + 58026994 58027010 1.0E-05 GGCGCCTTCTAGTGGGC 17
TFAP2C_TFAP_full_dimeric_12_1 SELEX + 58026836 58026847 8.0E-06 AGCCCCGGGGCA 12
FOXO3_forkhead_full_putatively-multimeric_11_1 SELEX + 58026152 58026162 2.0E-06 TTTCCTCACAC 11
FOXO1_forkhead_DBD_putatively-multimeric_12_1 SELEX + 58026152 58026163 9.0E-06 TTTCCTCACACA 12
RREB1_MA0073.1 JASPAR + 58026510 58026529 5.0E-06 CCCCTCACCAACCAATCCCA 20
V_NFAT3_Q3_M01734 TRANSFAC - 58026370 58026379 6.0E-06 ATTTTTTCCT 10
V_LYF1_01_M00141 TRANSFAC + 58027174 58027182 9.0E-06 TTTGGGAGG 9
V_WT1_Q6_01_M02036 TRANSFAC - 58027189 58027198 4.0E-06 CGCCCCCGCC 10
V_MTERF_01_M01245 TRANSFAC - 58026516 58026529 4.0E-06 TGGGATTGGTTGGT 14
V_POU3F2_01_M00463 TRANSFAC - 58026370 58026383 5.0E-06 CTGCATTTTTTCCT 14
V_ZF5_B_M00333 TRANSFAC + 58027191 58027203 0.0E+00 CGGGGGCGCGCTA 13
V_RREB1_01_M00257 TRANSFAC + 58026531 58026544 4.0E-06 CCCCACCCACCCCC 14
V_ZBTB4_04_M02929 TRANSFAC + 58027082 58027097 4.0E-06 CAAACACTGGCATCTC 16
V_SRF_01_M00152 TRANSFAC - 58027158 58027175 7.0E-06 AAGCCCTTATTTGCCCAT 18
V_TITF1_Q3_M00432 TRANSFAC + 58027211 58027220 6.0E-06 AGTCAAGTTT 10
V_NR2F2_04_M02887 TRANSFAC - 58026416 58026431 5.0E-06 CTCATCGGGTCACCTC 16
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL