Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MYADML2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 255275 myeloid-associated differentiation marker-like 2 chr17 - 79904609 - 79910109 79905109 Transcription Factor Binding Sites   Download all TFBS in the MYADML2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_TCF3_01_M01594 TRANSFAC + 79905938 79905950 2.0E-06 GCTTTCTTTTTTT 13 V_IRF_Q6_01_M00972 TRANSFAC - 79905939 79905949 5.0E-06 AAAAAAGAAAG 11 V_IRF2_Q6_M01882 TRANSFAC - 79905936 79905951 2.0E-06 TAAAAAAAGAAAGCCA 16 V_GKLF_02_M01588 TRANSFAC + 79905924 79905935 7.0E-06 ACCACGCCCAGC 12 V_TCFAP2E_04_M02926 TRANSFAC - 79905942 79905955 0.0E+00 TACTTAAAAAAAGA 14 V_IRF_Q6_M00772 TRANSFAC + 79905935 79905949 3.0E-06 CTGGCTTTCTTTTTT 15 V_MEF2_Q6_01_M00941 TRANSFAC + 79905941 79905952 9.0E-06 TTCTTTTTTTAA 12 V_SRF_06_M02916 TRANSFAC - 79905937 79905953 4.0E-06 CTTAAAAAAAGAAAGCC 17 V_NANOG_02_M01247 TRANSFAC - 79905933 79905952 0.0E+00 TTAAAAAAAGAAAGCCAGCT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.