Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

REXO1L1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 254958 chr8 + 86570726 - 86580726 0 Transcription Factor Binding Sites   Download all TFBS in the REXO1L1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Lhx8_homeodomain_DBD_dimeric_12_1 SELEX + 86572822 86572833 1.0E-05 TGATTGCAATGT 12 Lhx8_homeodomain_DBD_dimeric_12_1 SELEX - 86572822 86572833 9.0E-06 ACATTGCAATCA 12 Pax4_MA0068.1 JASPAR - 86572832 86572861 3.0E-06 GAAATTATTACAAACGGTCTCTCAGACCAC 30 V_SOX11_04_M02899 TRANSFAC - 86572848 86572861 9.0E-06 GAAATTATTACAAA 14 V_OCT1_03_M00137 TRANSFAC + 86572848 86572860 6.0E-06 TTTGTAATAATTT 13 V_PAX8_01_M00717 TRANSFAC + 86572785 86572799 3.0E-06 CGGTTTTGAGTGAGT 15 V_DMRT7_01_M01151 TRANSFAC + 86572849 86572862 9.0E-06 TTGTAATAATTTCT 14 V_SOX5_07_M02909 TRANSFAC - 86572848 86572864 2.0E-06 ACAGAAATTATTACAAA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.