Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

POTEH Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 23784 POTE ankyrin domain family, member H chr22 - 16287437 - 16292937 16287937 Transcription Factor Binding Sites   Download all TFBS in the POTEH promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Tp53_p53l_DBD_dimeric_18_2 SELEX + 16288488 16288505 8.0E-06 GGCATGCACGTGCAAGCC 18 V_P53_03_M01651 TRANSFAC - 16288497 16288516 8.0E-06 TGGCTTGTAAGGGCTTGCAC 20 V_P53_05_M01655 TRANSFAC - 16288497 16288516 5.0E-06 TGGCTTGTAAGGGCTTGCAC 20 V_P53_01_M00034 TRANSFAC - 16288487 16288506 5.0E-06 GGGCTTGCACGTGCATGCCG 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.