Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

NPAP1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 23742 nuclear pore associated protein 1 chr15 + 24915540 - 24921040 24920540 Transcription Factor Binding Sites   Download all TFBS in the NPAP1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FOXL1_forkhead_full_dimeric_13_1 SELEX + 24919226 24919238 8.0E-06 GTTAAATAAACCA 13 FOXC2_forkhead_DBD_dimeric_11_1 SELEX + 24919227 24919237 1.0E-05 TTAAATAAACC 11 V_COUPTF_Q6_M01036 TRANSFAC + 24919158 24919180 3.0E-06 GGTTCTGAACCTTCCACATGTCC 23 V_ZSCAN4_04_M02942 TRANSFAC + 24919185 24919200 1.0E-06 TCTGGCACACAACATT 16 V_NANOG_02_M01247 TRANSFAC + 24919227 24919246 9.0E-06 TTAAATAAACCAAAGAAACA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.