Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

TPSD1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 23430 chr16 + 1301272 - 1311272 0 Transcription Factor Binding Sites   Download all TFBS in the TPSD1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ESR2_MA0258.1 JASPAR + 1309301 1309318 3.0E-06 CTGGGTCTTGGTGTCCTG 18 ESR1_MA0112.2 JASPAR - 1309303 1309322 9.0E-06 CTCACAGGACACCAAGACCC 20 V_ESR1_01_M02261 TRANSFAC - 1309303 1309322 9.0E-06 CTCACAGGACACCAAGACCC 20 V_ESR2_01_M02377 TRANSFAC + 1309301 1309318 3.0E-06 CTGGGTCTTGGTGTCCTG 18

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.