Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

KIAA1024 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 23251 KIAA1024 chr15 + 79719857 - 79725357 79724857 Transcription Factor Binding Sites   Download all TFBS in the KIAA1024 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Creb3l2_bZIP_DBD_dimeric_13_1 SELEX - 79724448 79724460 5.0E-06 CGCCACGTCATGG 13 V_LRH1_Q5_M01142 TRANSFAC + 79723971 79723982 1.0E-05 CTGGCCTTGCAA 12 V_SMAD4_04_M02898 TRANSFAC + 79724345 79724361 4.0E-06 TGCGCCCCGCCAGCTTG 17 V_NANOG_01_M01123 TRANSFAC - 79726078 79726089 6.0E-06 AGGGCCATTTAC 12 V_STAT1_05_M01260 TRANSFAC - 79726090 79726111 6.0E-06 GGTGTCTGAGAAATGACAAGGA 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.