Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CCDC129 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 223075 coiled-coil domain containing 129 chr7 + 31548684 - 31554184 31553684 Transcription Factor Binding Sites   Download all TFBS in the CCDC129 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints THRB_nuclearreceptor_DBD_dimeric_20_1 SELEX + 31551979 31551998 5.0E-06 ATGATCTTACACAAGGATAT 20 V_MEF2_02_M00231 TRANSFAC - 31551945 31551966 8.0E-06 ACATTTCCTTAAAATAGAGTCA 22 V_ISL2_01_M01328 TRANSFAC - 31551952 31551967 7.0E-06 CACATTTCCTTAAAAT 16 V_MEF2_03_M00232 TRANSFAC - 31551945 31551966 1.0E-06 ACATTTCCTTAAAATAGAGTCA 22 V_ELF5_01_M01197 TRANSFAC + 31551955 31551965 1.0E-05 TTAAGGAAATG 11 V_MEF2_04_M00233 TRANSFAC - 31551945 31551966 2.0E-06 ACATTTCCTTAAAATAGAGTCA 22 V_AR_Q6_M00962 TRANSFAC - 31551963 31551971 6.0E-06 TGAGCACAT 9

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.