Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FCGR2B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2213 Fc fragment of IgG, low affinity IIb, receptor (CD32) chr1 + 161627904 - 161633404 161632904 Transcription Factor Binding Sites   Download all TFBS in the FCGR2B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints POU3F3_POU_DBD_monomeric_13_1 SELEX + 161628671 161628683 9.0E-06 AGTATGTAAAATT 13 POU2F1_POU_DBD_monomeric_12_1 SELEX + 161628671 161628682 8.0E-06 AGTATGTAAAAT 12 V_OCT1_01_M00135 TRANSFAC + 161628668 161628686 9.0E-06 GAGAGTATGTAAAATTGGA 19 V_AP1_Q6_M00174 TRANSFAC - 161629896 161629906 1.0E-05 GATGACTTATT 11 V_HOX13_01_M00023 TRANSFAC - 161631820 161631849 1.0E-06 TGTCATCATCCTCATTACCATTTGTTCACC 30 V_MYOGNF1_01_M00056 TRANSFAC - 161631842 161631870 0.0E+00 TAGTTCTCTTTTCTTGCGTTCTGTCATCA 29 V_OCT1_06_M00162 TRANSFAC - 161628671 161628684 3.0E-06 CAATTTTACATACT 14 V_DMRT2_01_M01147 TRANSFAC - 161628679 161628694 1.0E-06 CAAATGGTTCCAATTT 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.