Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FCGR1B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2210 Fc fragment of IgG, high affinity Ib, receptor (CD64) chr1 - 120935444 - 120940944 120935944 Transcription Factor Binding Sites   Download all TFBS in the FCGR1B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FOXO1_forkhead_DBD_dimeric_14_1 SELEX + 120935887 120935900 1.0E-05 AACCACATGTTGTC 14 V_TGIF_01_M00418 TRANSFAC + 120935877 120935887 7.0E-06 AGTTGTCAAGA 11 V_NKX24_01_M01350 TRANSFAC - 120935940 120935955 8.0E-06 AGAACCTCTTCAATAT 16 V_MEF2A_Q6_M02024 TRANSFAC - 120932164 120932173 2.0E-06 TATTTTAAAA 10 V_FOXO1_04_M01969 TRANSFAC + 120935881 120935900 0.0E+00 GTCAAGAACCACATGTTGTC 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.