Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FCGR1A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2209 Fc fragment of IgG, high affinity Ia, receptor (CD64) chr1 + 149749249 - 149754749 149754249 Transcription Factor Binding Sites   Download all TFBS in the FCGR1A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_MEF2_02_M00231 TRANSFAC - 149754469 149754490 9.0E-06 TCCTTTTCATAAAATAAGCTCT 22 V_OCT_C_M00210 TRANSFAC - 149754479 149754491 5.0E-06 ATCCTTTTCATAA 13 V_HOXD13_01_M01404 TRANSFAC - 149754473 149754488 7.0E-06 CTTTTCATAAAATAAG 16 V_ELF4_04_M02850 TRANSFAC - 149754470 149754486 4.0E-06 TTTCATAAAATAAGCTC 17 V_SOX17_04_M02904 TRANSFAC - 149754476 149754492 6.0E-06 CATCCTTTTCATAAAAT 17 V_AIRE_01_M00999 TRANSFAC + 149754479 149754504 9.0E-06 TTATGAAAAGGATGGGAAGGGCAACC 26 V_HOXD10_01_M01375 TRANSFAC - 149754472 149754488 4.0E-06 CTTTTCATAAAATAAGC 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.