Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FCER1A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 2205 chr1 + 159254503 - 159264503 0 Transcription Factor Binding Sites   Download all TFBS in the FCER1A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints POU1F1_POU_DBD_monomeric_14_1 SELEX + 159260613 159260626 9.0E-06 CTTATGGAAATCAA 14 NFATC1_NFAT_full_dimeric_20_1 SELEX + 159260615 159260634 1.0E-06 TATGGAAATCAAGTTTTTAA 20 POU3F1_POU_DBD_monomeric_12_1 SELEX + 159260614 159260625 4.0E-06 TTATGGAAATCA 12 FOXI1_forkhead_full_dimeric_17_1 SELEX + 159260610 159260626 4.0E-06 CTGCTTATGGAAATCAA 17 POU3F2_POU_DBD_monomeric_12_1 SELEX + 159260614 159260625 4.0E-06 TTATGGAAATCA 12 V_OCT1_Q5_01_M00930 TRANSFAC - 159260615 159260625 3.0E-06 TGATTTCCATA 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.