Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 219293 chr1 + 1380068 - 1390068 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_HMGIY_Q3_M01010 TRANSFAC - 1387990 1388004 2.0E-06 ACTGCATTTTCTTCT 15 V_ZIC2_05_M02940 TRANSFAC + 1387922 1387936 2.0E-06 TCTCCCAGCATGGAA 15 V_FPM315_01_M01587 TRANSFAC - 1387967 1387978 3.0E-06 GAGGGAGGAGCG 12 V_P53_04_M01652 TRANSFAC - 1387934 1387953 4.0E-06 GGTCCAGTTTGGGCTTGTTC 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.