Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

HTR3C Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 170572 5-hydroxytryptamine (serotonin) receptor 3C, ionotropic chr3 + 183765834 - 183771334 183770834 Transcription Factor Binding Sites   Download all TFBS in the HTR3C promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints HSF2_HSF_DBD_trimeric_13_1 SELEX + 183767123 183767135 7.0E-06 TTCTAGATGTTTT 13 Mafb_bZIP_DBD_monomeric_12_1 SELEX - 183769630 183769641 7.0E-06 AAAGTGCTGAGA 12 HOXA5_MA0158.1 JASPAR + 183769662 183769669 7.0E-06 CACTAATT 8 FOXJ2_forkhead_DBD_dimeric_14_1 SELEX - 183769680 183769693 6.0E-06 GAATACAAAAAAAA 14 V_BCL6_01_M01183 TRANSFAC - 183769676 183769691 6.0E-06 ATACAAAAAAAACTTT 16 V_PITX2_Q6_M02114 TRANSFAC + 183767167 183767176 1.0E-06 TGTAAACCCA 10 V_TCFAP2E_04_M02926 TRANSFAC - 183769680 183769693 1.0E-05 GAATACAAAAAAAA 14 V_ELF4_04_M02850 TRANSFAC - 183769676 183769692 1.0E-06 AATACAAAAAAAACTTT 17 V_MRF2_01_M00454 TRANSFAC - 183769685 183769698 2.0E-06 ATGTAGAATACAAA 14 V_HOXA5_03_M02271 TRANSFAC + 183769662 183769669 7.0E-06 CACTAATT 8 V_MTF1_06_M02882 TRANSFAC - 183769680 183769693 5.0E-06 GAATACAAAAAAAA 14 V_SRF_06_M02916 TRANSFAC - 183769676 183769692 1.0E-06 AATACAAAAAAAACTTT 17 V_SRF_06_M02916 TRANSFAC - 183769677 183769693 2.0E-06 GAATACAAAAAAAACTT 17 V_ARID5A_04_M02840 TRANSFAC - 183769681 183769697 1.0E-06 TGTAGAATACAAAAAAA 17 V_NANOG_02_M01247 TRANSFAC - 183769678 183769697 3.0E-06 TGTAGAATACAAAAAAAACT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.