Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SYNE4 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 163183 spectrin repeat containing, nuclear envelope family member 4 chr19 - 36499172 - 36504672 36499672 Transcription Factor Binding Sites   Download all TFBS in the SYNE4 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints SP4_C2H2_full_monomeric_17_1 SELEX + 36499714 36499730 8.0E-06 CTGGCTCCGCCCCTTCC 17 TBX4_TBX_DBD_dimeric_20_1 SELEX + 36499768 36499787 5.0E-06 AGGTGACAGAAGAGTCACTT 20 V_GC_01_M00255 TRANSFAC - 36499715 36499728 4.0E-06 AAGGGGCGGAGCCA 14 V_SP1_Q6_M00196 TRANSFAC - 36499716 36499728 6.0E-06 AAGGGGCGGAGCC 13 V_GLI3_Q5_01_M01657 TRANSFAC + 36499526 36499534 6.0E-06 GTGGGTGGT 9 V_ZIC2_05_M02940 TRANSFAC + 36500196 36500210 4.0E-06 TTGCCCAGCAGGAGG 15 V_CNOT3_01_M01253 TRANSFAC + 36500283 36500292 4.0E-06 GGCCGCGCCG 10 V_SP1_Q4_01_M00932 TRANSFAC - 36499716 36499728 4.0E-06 AAGGGGCGGAGCC 13 V_ZIC1_05_M02939 TRANSFAC + 36500196 36500210 8.0E-06 TTGCCCAGCAGGAGG 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.