Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 163154 chr19 + 5779776 - 5789776 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_SMAD3_Q6_01_M01888 TRANSFAC + 5783108 5783120 6.0E-06 TGCCAGACAGAAT 13 V_MUSCLE_INI_B_M00321 TRANSFAC - 5783122 5783142 1.0E-06 TGCCACCAACACCCCGGCCCC 21 V_SMAD_Q6_01_M00974 TRANSFAC + 5783107 5783117 2.0E-06 TTGCCAGACAG 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.